Central Dogma Practice Problems

Question #1

You are given a solution containing only the enzyme DNA Polymerase III, the nucleotide precursors dATP, dTTP, DCTP, and dGTP and any necessary ions. You perform 4 separate experiments in which you add a DNA molecule to the solution and test for DNA synthesizing activity. Which of the DNA molecules listed below would lead to DNA synthesis when added to your solution? Explain why or why not in each case.
  1. A single-stranded closed circle containing 1000 nucleotides
  2. A double-stranded closed circle containing 1000 nucleotide pairs
  3. A single-stranded closed circle of 1000 nucleotides base paired to a linear strand of 500 nucleotides with a free 3'-OH terminus.
  4. A double-stranded linear molecule of 1000 nucleotide pairs with a free 3'-OH at each end.

Question #2

A bacterial DNA sequence is transcribed into a complementary copy of RNA, which in turn is translated into a protein sequence by ribosomes and aminoacyl-tRNA complexes. Starting from each DNA strand below, indicate the mRNA transcript and predict the protein (amino acid sequence) that could be synthesized in vitro.
3' ATACGAGTCACAGAGTCGTGTAAC 5'

5' TATGCTCAGTGTCTCAGCACATTG 3'


Question #3

A) Approximately how many molecules of NTPs (nucleoside triphosphates: ATP, GTP, CTP, or UTP) would be consumed in transcribing and translating a bacterial gene into a protein that is 100 amino acids long? Explain your reasoning. (You need not give exact numbers but try to include all categories).

B) Would you expect a protein of 100 amino acids in a typical eukaryotic cell to require the same, less or more ATP, GTP, CTP, and UTP for transcription and translation compared to a bacterium? Explain.

To view answers to these questions, jump to Solutions