Science Gateway > Protocols > Cell Biology Protocols - Table of Contents
Star Republic: Guide for Biologists

T3/T7/SP6 minimum promotor sequences

ChangBioscience.com
The +1 base (in bold) is the first base incorporated into RNA. The minimum promoter sequence needed for efficient transcription is highlighted in red.

T3 AATTAACCCTCACTAAAGGGAGA
T7 TAATACGACTCACTATAGGGAGA
SP6 ATTTAGGTGACACTATAGAAGNG